airavata-commits mailing list archives

Site index · List index
Message view « Date » · « Thread »
Top « Date » · « Thread »
From shame...@apache.org
Subject [3/4] airavata git commit: removed gfac-ec2, gfac-gram and gfac-hadoop modules from source.
Date Fri, 08 May 2015 15:55:18 GMT
http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java b/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java
deleted file mode 100644
index 9f86197..0000000
--- a/modules/gfac/gfac-ec2/src/test/java/org/apache/airavata/gfac/ec2/EC2ProviderTest.java
+++ /dev/null
@@ -1,195 +0,0 @@
-///*
-// *
-// * Licensed to the Apache Software Foundation (ASF) under one
-// * or more contributor license agreements.  See the NOTICE file
-// * distributed with this work for additional information
-// * regarding copyright ownership.  The ASF licenses this file
-// * to you under the Apache License, Version 2.0 (the
-// * "License"); you may not use this file except in compliance
-// * with the License.  You may obtain a copy of the License at
-// *
-// *   http://www.apache.org/licenses/LICENSE-2.0
-// *
-// * Unless required by applicable law or agreed to in writing,
-// * software distributed under the License is distributed on an
-// * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
-// * KIND, either express or implied.  See the License for the
-// * specific language governing permissions and limitations
-// * under the License.
-// *
-// */
-//
-//package org.apache.airavata.gfac.ec2;
-//
-//import org.airavata.appcatalog.cpi.AppCatalog;
-//import org.apache.aiaravata.application.catalog.data.impl.AppCatalogFactory;
-//import org.apache.airavata.commons.gfac.type.*;
-//import org.apache.airavata.gfac.GFacConfiguration;
-//import org.apache.airavata.gfac.GFacException;
-//import org.apache.airavata.gfac.core.context.ApplicationContext;
-//import org.apache.airavata.gfac.core.context.JobExecutionContext;
-//import org.apache.airavata.gfac.core.context.MessageContext;
-//import org.apache.airavata.gfac.core.cpi.BetterGfacImpl;
-//import org.apache.airavata.model.appcatalog.computeresource.*;
-//import org.apache.airavata.schemas.gfac.*;
-//import org.junit.Assert;
-//import org.junit.Before;
-//import org.junit.Test;
-//
-//import java.io.File;
-//import java.net.URL;
-//import java.util.ArrayList;
-//import java.util.List;
-//
-///**
-// * Your Amazon instance should be in a running state before running this test.
-// */
-//public class EC2ProviderTest {
-//    private JobExecutionContext jobExecutionContext;
-//
-//    private static final String hostName = "ec2-host";
-//
-//    private static final String hostAddress = "ec2-address";
-//
-//    private static final String sequence1 = "RR042383.21413#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" +
-//            "CTCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCCTGCGCCCATTGACCAATATTCCTCA" +
-//            "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" +
-//            "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAATCTTCCTTTCAGAAG" +
-//            "GCTGTCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCCGCCGGTCGCCATCAGTCTTAGCAAGCTAAGACCATGCTGCCCCTGACTTGCATGT" +
-//            "GTTAAGCCTGTAGCTTAGCGTTC";
-//
-//    private static final String sequence2 = "RR042383.31934#CTGGCACGGAGTTAGCCGATCCTTATTCATAAAGTACATGCAAACGGGTATCCATA" +
-//            "CCCGACTTTATTCCTTTATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGGCTCTCGCCCATTGACCAATATTCCTCA" +
-//            "CTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGAAGACTAGGTGGGCCGTTACCCCGC" +
-//            "CTACTATCTAATGGAACGCATCCCCATCGTCTACCGGAATACCTTTAATCATGTGAACATGCGGACTCATGATGCCATCTTGTATTAAATCTTCCTTTCAGAA" +
-//            "GGCTATCCAAGAGTAGACGGCAGGTTGGATACGTGTTACTCACCGTGCG";
-//
-//    /* Following variables are needed to be set in-order to run the test. Since these are account specific information,
-//       I'm not adding the values here. It's the responsibility of the person who's running the test to update
-//       these variables accordingly.
-//       */
-//
-//    /* Username used to log into your ec2 instance eg.ec2-user */
-//    private String userName = "";
-//
-//    /* Secret key used to connect to the image */
-//    private String secretKey = "";
-//
-//    /* Access key used to connect to the image */
-//    private String accessKey = "";
-//
-//    /* Instance id of the running instance of your image */
-//    private String instanceId = "";
-//
-//    @Before
-//    public void setUp() throws Exception {
-//        URL resource = EC2ProviderTest.class.getClassLoader().getResource(org.apache.airavata.common.utils.Constants.GFAC_CONFIG_XML);
-//        assert resource != null;
-//        System.out.println(resource.getFile());
-//        GFacConfiguration gFacConfiguration = GFacConfiguration.create(new File(resource.getPath()), null);
-//
-//        /* EC2 Host */
-//        ComputeResourceDescription host = new ComputeResourceDescription();
-//        host.setHostName(hostName);
-//        host.setResourceDescription("EC2 compute resource");
-//        host.addToIpAddresses(hostAddress);
-//
-//        CloudJobSubmission cloudJobSubmission = new CloudJobSubmission();
-//        cloudJobSubmission.setProviderName(ProviderName.EC2);
-//        cloudJobSubmission.setExecutableType("sh");
-//        cloudJobSubmission.setNodeId(instanceId);
-//        cloudJobSubmission.setSecurityProtocol(SecurityProtocol.USERNAME_PASSWORD);
-//        cloudJobSubmission.setUserAccountName(userName);
-//
-//        AppCatalog appCatalog = AppCatalogFactory.getAppCatalog();
-//        String submissionId = appCatalog.getComputeResource().addCloudJobSubmission(cloudJobSubmission);
-//
-//        JobSubmissionInterface submissionInterface = new JobSubmissionInterface();
-//        submissionInterface.setJobSubmissionInterfaceId(submissionId);
-//        submissionInterface.setJobSubmissionProtocol(JobSubmissionProtocol.CLOUD);
-//        submissionInterface.setPriorityOrder(0);
-//
-//        host.addToJobSubmissionInterfaces(submissionInterface);
-//
-//        String computeResourceId = appCatalog.getComputeResource().addComputeResource(host);
-//
-//        /* App */
-//
-//        ApplicationDescription ec2Desc = new ApplicationDescription(Ec2ApplicationDeploymentType.type);
-//        Ec2ApplicationDeploymentType ec2App = (Ec2ApplicationDeploymentType)ec2Desc.getType();
-//
-//        String serviceName = "Gnome_distance_calculation_workflow";
-//        ec2Desc.getType().addNewApplicationName().setStringValue(serviceName);
-//        ec2App.setJobType(JobTypeType.EC_2);
-//        ec2App.setExecutable("/home/ec2-user/run.sh");
-//        ec2App.setExecutableType("sh");
-//
-//        /* Service */
-//        ServiceDescription serv = new ServiceDescription();
-//        serv.getType().setName("GenomeEC2");
-//
-//        List<InputParameterType> inputList = new ArrayList<InputParameterType>();
-//
-//        InputParameterType input1 = InputParameterType.Factory.newInstance();
-//        input1.setParameterName("genome_input1");
-//        input1.setParameterType(StringParameterType.Factory.newInstance());
-//        inputList.add(input1);
-//
-//        InputParameterType input2 = InputParameterType.Factory.newInstance();
-//        input2.setParameterName("genome_input2");
-//        input2.setParameterType(StringParameterType.Factory.newInstance());
-//        inputList.add(input2);
-//
-//        InputParameterType[] inputParamList = inputList.toArray(new InputParameterType[inputList.size()]);
-//
-//        List<OutputParameterType> outputList = new ArrayList<OutputParameterType>();
-//        OutputParameterType output = OutputParameterType.Factory.newInstance();
-//        output.setParameterName("genome_output");
-//        output.setParameterType(StringParameterType.Factory.newInstance());
-//        outputList.add(output);
-//
-//        OutputParameterType[] outputParamList = outputList
-//                .toArray(new OutputParameterType[outputList.size()]);
-//
-//        serv.getType().setInputParametersArray(inputParamList);
-//        serv.getType().setOutputParametersArray(outputParamList);
-//
-//        jobExecutionContext = new JobExecutionContext(gFacConfiguration,serv.getType().getName());
-//        ApplicationContext applicationContext = new ApplicationContext();
-//        jobExecutionContext.setApplicationContext(applicationContext);
-//        applicationContext.setServiceDescription(serv);
-//        applicationContext.setApplicationDeploymentDescription(ec2Desc);
-//        applicationContext.setHostDescription(host);
-//
-//        AmazonSecurityContext amazonSecurityContext =
-//                new AmazonSecurityContext(userName, accessKey, secretKey, instanceId);
-//        jobExecutionContext.addSecurityContext(AmazonSecurityContext.AMAZON_SECURITY_CONTEXT, amazonSecurityContext);
-//
-//        MessageContext inMessage = new MessageContext();
-//        ActualParameter genomeInput1 = new ActualParameter();
-//        ((StringParameterType)genomeInput1.getType()).setValue(sequence1);
-//        inMessage.addParameter("genome_input1", genomeInput1);
-//
-//        ActualParameter genomeInput2 = new ActualParameter();
-//        ((StringParameterType)genomeInput2.getType()).setValue(sequence2);
-//        inMessage.addParameter("genome_input2", genomeInput2);
-//
-//        MessageContext outMessage = new MessageContext();
-//        ActualParameter echo_out = new ActualParameter();
-//        outMessage.addParameter("distance", echo_out);
-//
-//        jobExecutionContext.setInMessageContext(inMessage);
-//        jobExecutionContext.setOutMessageContext(outMessage);
-//    }
-//
-//    @Test
-//    public void testGramProvider() throws GFacException {
-//        BetterGfacImpl gFacAPI = new BetterGfacImpl();
-//        gFacAPI.submitJob(jobExecutionContext.getExperimentID(), jobExecutionContext.getTaskData().getTaskID(), jobExecutionContext.getGatewayID());
-//        MessageContext outMessageContext = jobExecutionContext.getOutMessageContext();
-//        Assert.assertEquals(MappingFactory.
-//                toString((ActualParameter) outMessageContext.getParameter("genome_output")), "476");
-//    }
-//}
-//
-//

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/resources/echo.bat
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ec2/src/test/resources/echo.bat b/modules/gfac/gfac-ec2/src/test/resources/echo.bat
deleted file mode 100644
index c6b849b..0000000
--- a/modules/gfac/gfac-ec2/src/test/resources/echo.bat
+++ /dev/null
@@ -1,22 +0,0 @@
-::
-::
-:: Licensed to the Apache Software Foundation (ASF) under one
-:: or more contributor license agreements.  See the NOTICE file
-:: distributed with this work for additional information
-:: regarding copyright ownership.  The ASF licenses this file
-:: to you under the Apache License, Version 2.0 (the
-:: "License"); you may not use this file except in compliance
-:: with the License.  You may obtain a copy of the License at
-::
-::   http://www.apache.org/licenses/LICENSE-2.0
-::
-:: Unless required by applicable law or agreed to in writing,
-:: software distributed under the License is distributed on an
-:: "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
-:: KIND, either express or implied.  See the License for the
-:: specific language governing permissions and limitations
-:: under the License.
-::
-::
-@echo off
-echo %1^=%2
\ No newline at end of file

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/resources/logging.properties
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ec2/src/test/resources/logging.properties b/modules/gfac/gfac-ec2/src/test/resources/logging.properties
deleted file mode 100644
index 0584d38..0000000
--- a/modules/gfac/gfac-ec2/src/test/resources/logging.properties
+++ /dev/null
@@ -1,42 +0,0 @@
-#
-# Licensed to the Apache Software Foundation (ASF) under one
-# or more contributor license agreements. See the NOTICE file
-# distributed with this work for additional information
-# regarding copyright ownership. The ASF licenses this file
-# to you under the Apache License, Version 2.0 (the
-# "License"); you may not use this file except in compliance
-# with the License. You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing,
-# software distributed under the License is distributed on an
-# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
-# KIND, either express or implied. See the License for the
-# specific language governing permissions and limitations
-# under the License.
-#
-#
-#default/fallback log4j configuration
-#
-
-# Set root logger level to WARN and its only appender to A1.
-log4j.rootLogger=INFO, A1, A2
-
-# A1 is set to be a rolling file appender with default params
-log4j.appender.A1=org.apache.log4j.RollingFileAppender
-log4j.appender.A1.File=target/seclogs.txt
-
-# A1 uses PatternLayout.
-log4j.appender.A1.layout=org.apache.log4j.PatternLayout
-log4j.appender.A1.layout.ConversionPattern=%d [%t] %-5p %c %x - %m%n
-
-# A2 is a console appender
-log4j.appender.A2=org.apache.log4j.ConsoleAppender
-
-# A2 uses PatternLayout.
-log4j.appender.A2.layout=org.apache.log4j.PatternLayout
-log4j.appender.A2.layout.ConversionPattern=%d [%t] %-5p %c{1} %x - %m%n
-
-log4j.logger.unicore.security=INFO
-

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-ec2/src/test/resources/service.properties
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-ec2/src/test/resources/service.properties b/modules/gfac/gfac-ec2/src/test/resources/service.properties
deleted file mode 100644
index e266d13..0000000
--- a/modules/gfac/gfac-ec2/src/test/resources/service.properties
+++ /dev/null
@@ -1,67 +0,0 @@
-#
-#
-# Licensed to the Apache Software Foundation (ASF) under one
-# or more contributor license agreements.  See the NOTICE file
-# distributed with this work for additional information
-# regarding copyright ownership.  The ASF licenses this file
-# to you under the Apache License, Version 2.0 (the
-# "License"); you may not use this file except in compliance
-# with the License.  You may obtain a copy of the License at
-#
-#   http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing,
-# software distributed under the License is distributed on an
-# "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
-# KIND, either express or implied.  See the License for the
-# specific language governing permissions and limitations
-# under the License.
-#
-#
-
-#
-# Properties for JCR Registry interface. By default, Apache Jackrabbit is used.
-#
-# org.apache.jackrabbit.repository.uri=http://localhost:8080/rmi
-# jcr.class=org.apache.jackrabbit.rmi.repository.RmiRepositoryFactory
-jcr.class=org.apache.jackrabbit.core.RepositoryFactoryImpl
-jcr.user=admin
-jcr.pass=admin
-
-
-#
-# Class which implemented Scheduler interface. It will be used to determine a Provider
-#
-scheduler.class= org.apache.airavata.core.gfac.scheduler.impl.SchedulerImpl
-
-#
-# Data Service Plugins classes
-#
-datachain.classes= org.apache.airavata.core.gfac.extension.data.RegistryDataService
-
-#
-# Pre execution Plugins classes. For example, GridFTP Input Staging
-#
-prechain.classes= org.apache.airavata.core.gfac.extension.pre.GridFtpInputStaging 
-prechain.classes= org.apache.airavata.core.gfac.extension.pre.HttpInputStaging
-
-#
-# Post execution Plugins classes. For example, GridFTP Output Staging
-#
-postchain.classes= org.apache.airavata.core.gfac.extension.post.GridFtpOutputStaging
-postchain.classes= org.apache.airavata.core.gfac.extension.post.OutputRegister
-
-#
-# SSH private key location. It will be used by SSHProvider
-#
-# ssh.key=/home/user/.ssh/id_rsa
-# ssh.keypass=
-# ssh.username=usernameAtHost
-
-#
-# MyProxy credential. It will be used by GridFTP Plugins and GramProvider.
-#
-# myproxy.server=myproxy.teragrid.org
-# myproxy.user=username
-# myproxy.pass=password
-# myproxy.life=3600
\ No newline at end of file

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/pom.xml
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gram/pom.xml b/modules/gfac/gfac-gram/pom.xml
deleted file mode 100644
index ac58e15..0000000
--- a/modules/gfac/gfac-gram/pom.xml
+++ /dev/null
@@ -1,124 +0,0 @@
-<?xml version="1.0" encoding="UTF-8"?>
-
-<!--Licensed to the Apache Software Foundation (ASF) under one or more contributor license agreements. See the NOTICE file 
-    distributed with this work for additional information regarding copyright ownership. The ASF licenses this file to you under 
-    the Apache License, Version 2.0 (theƏ "License"); you may not use this file except in compliance with the License. You may 
-    obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to 
-    in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF 
-    ANY ~ KIND, either express or implied. See the License for the specific language governing permissions and limitations under 
-    the License. -->
-
-<project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd">
-    <parent>
-        <groupId>org.apache.airavata</groupId>
-        <artifactId>gfac</artifactId>
-        <version>0.14-SNAPSHOT</version>
-        <relativePath>../pom.xml</relativePath>
-    </parent>
-
-    <modelVersion>4.0.0</modelVersion>
-    <artifactId>airavata-gfac-gram</artifactId>
-    <name>Airavata GFac GRAM implementation</name>
-    <description>This is the extension of GFAC to use GRAM</description>
-    <url>http://airavata.apache.org/</url>
-
-    <dependencies>
-        <dependency>
-            <groupId>org.jglobus</groupId>
-            <artifactId>gss</artifactId>
-            <version>${jglobus.version}</version>
-        </dependency>
-        <dependency>
-            <groupId>org.jglobus</groupId>
-            <artifactId>gram</artifactId>
-            <version>${jglobus.version}</version>
-        </dependency>
-        <dependency>
-            <groupId>org.jglobus</groupId>
-            <artifactId>myproxy</artifactId>
-            <version>${jglobus.version}</version>
-        </dependency>
-        <dependency>
-            <groupId>org.jglobus</groupId>
-            <artifactId>gridftp</artifactId>
-            <version>${jglobus.version}</version>
-        </dependency>
-
-        <!-- Logging -->
-        <dependency>
-            <groupId>org.slf4j</groupId>
-            <artifactId>slf4j-api</artifactId>
-        </dependency>
-
-        <!-- GFAC schemas -->
-        <dependency>
-            <groupId>org.apache.airavata</groupId>
-            <artifactId>airavata-gfac-core</artifactId>
-            <version>${project.version}</version>
-        </dependency>
-        <!-- Credential Store -->
-        <dependency>
-            <groupId>org.apache.airavata</groupId>
-            <artifactId>airavata-credential-store</artifactId>
-            <version>${project.version}</version>
-        </dependency>
-        <dependency>
-            <groupId>org.apache.airavata</groupId>
-            <artifactId>airavata-server-configuration</artifactId>
-            <scope>test</scope>
-        </dependency>
-        <dependency>
-            <groupId>org.apache.airavata</groupId>
-            <artifactId>airavata-client-configuration</artifactId>
-            <scope>test</scope>
-        </dependency>
-
-
-        <!-- Test -->
-        <dependency>
-            <groupId>junit</groupId>
-            <artifactId>junit</artifactId>
-            <scope>test</scope>
-        </dependency>
-        <dependency>
-            <groupId>org.testng</groupId>
-            <artifactId>testng</artifactId>
-            <version>6.1.1</version>
-            <scope>test</scope>
-        </dependency>
-        <dependency>
-            <groupId>org.slf4j</groupId>
-            <artifactId>jcl-over-slf4j</artifactId>
-            <scope>test</scope>
-        </dependency>
-        <dependency>
-            <groupId>org.slf4j</groupId>
-            <artifactId>slf4j-log4j12</artifactId>
-            <scope>test</scope>
-        </dependency>
-
-        <!-- gsi-ssh api dependencies -->
-
-        <dependency>
-            <groupId>org.apache.airavata</groupId>
-            <artifactId>airavata-data-models</artifactId>
-            <version>${project.version}</version>
-        </dependency>
-        <dependency>
-            <groupId>com.jcraft</groupId>
-            <artifactId>jsch</artifactId>
-            <version>0.1.50</version>
-        </dependency>
-        <dependency>
-            <groupId>org.ogce</groupId>
-            <artifactId>bcgss</artifactId>
-            <version>146</version>
-        </dependency>
-        <dependency>
-            <groupId>org.apache.xmlbeans</groupId>
-            <artifactId>xmlbeans</artifactId>
-            <version>${xmlbeans.version}</version>
-        </dependency>
-
-    </dependencies>
-</project>

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java
deleted file mode 100644
index fef9fad..0000000
--- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/external/GridFtp.java
+++ /dev/null
@@ -1,558 +0,0 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements.  See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership.  The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License.  You may obtain a copy of the License at
- *
- *   http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied.  See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
- */
-
-package org.apache.airavata.gfac.gram.external;
-
-import java.io.BufferedReader;
-import java.io.File;
-import java.io.FileNotFoundException;
-import java.io.FileReader;
-import java.io.IOException;
-import java.io.InputStream;
-import java.net.URI;
-import java.net.URISyntaxException;
-import java.util.ArrayList;
-import java.util.Arrays;
-import java.util.HashSet;
-import java.util.List;
-import java.util.Set;
-import java.util.Vector;
-
-import org.apache.airavata.gfac.Constants;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.ToolsException;
-import org.apache.airavata.gfac.gram.util.GramProviderUtils;
-import org.apache.airavata.gfac.gram.util.GridFTPContactInfo;
-import org.globus.ftp.DataChannelAuthentication;
-import org.globus.ftp.DataSourceStream;
-import org.globus.ftp.FileInfo;
-import org.globus.ftp.GridFTPClient;
-import org.globus.ftp.HostPort;
-import org.globus.ftp.Marker;
-import org.globus.ftp.MarkerListener;
-import org.globus.ftp.MlsxEntry;
-import org.globus.ftp.Session;
-import org.globus.ftp.exception.ClientException;
-import org.globus.ftp.exception.ServerException;
-import org.globus.gsi.gssapi.auth.HostAuthorization;
-import org.ietf.jgss.GSSCredential;
-import org.slf4j.Logger;
-import org.slf4j.LoggerFactory;
-
-/**
- * GridFTP tools
- */
-public class GridFtp {
-    public static final Logger log = LoggerFactory.getLogger(GridFtp.class);
-
-    public static final String GSIFTP_SCHEME = "gsiftp";
-    public static final String HOST = "host";
-
-    /**
-     * Make directory at remote location
-     *
-     * @param destURI
-     * @param gssCred
-     * @throws ServerException
-     * @throws IOException
-     */
-    public void makeDir(URI destURI, GSSCredential gssCred) throws ToolsException {
-        GridFTPClient destClient = null;
-        GridFTPContactInfo destHost = new GridFTPContactInfo(destURI.getHost(), destURI.getPort());
-        try {
-
-            String destPath = destURI.getPath();
-            log.info(("Creating Directory = " + destHost + "=" + destPath));
-
-            destClient = new GridFTPClient(destHost.hostName, destHost.port);
-
-            int tryCount = 0;
-            while (true) {
-                try {
-                    destClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-                    destClient.authenticate(gssCred);
-                    destClient.setDataChannelAuthentication(DataChannelAuthentication.SELF);
-
-                    if (!destClient.exists(destPath)) {
-                        destClient.makeDir(destPath);
-                    }
-                    break;
-                } catch (ServerException e) {
-                    tryCount++;
-                    if (tryCount >= 3) {
-                        throw new ToolsException(e.getMessage(), e);
-                    }
-                    Thread.sleep(10000);
-                } catch (IOException e) {
-                    tryCount++;
-                    if (tryCount >= 3) {
-                        throw new ToolsException(e.getMessage(), e);
-                    }
-                    Thread.sleep(10000);
-                }
-            }
-        } catch (ServerException e) {
-            throw new ToolsException("Cannot Create GridFTP Client to:" + destHost.toString(), e);
-        } catch (IOException e) {
-            throw new ToolsException("Cannot Create GridFTP Client to:" + destHost.toString(), e);
-        } catch (InterruptedException e) {
-            throw new ToolsException("Internal Error cannot sleep", e);
-        } finally {
-            if (destClient != null) {
-                try {
-                    destClient.close();
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection",e);
-                }
-            }
-        }
-    }
-
-    /**
-     * Upload file from stream
-     *
-     * @param destURI
-     * @param gsCredential
-     * @param io
-     * @throws GFacException
-     */
-    public void uploadFile(URI destURI, GSSCredential gsCredential, InputStream io) throws ToolsException {
-        GridFTPClient ftpClient = null;
-        GridFTPContactInfo contactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort());
-
-        try {
-
-            String remoteFile = destURI.getPath();
-            log.info("The remote file is " + remoteFile);
-
-            log.debug("Setup GridFTP Client");
-
-            ftpClient = new GridFTPClient(contactInfo.hostName, contactInfo.port);
-            ftpClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-            ftpClient.authenticate(gsCredential);
-            ftpClient.setDataChannelAuthentication(DataChannelAuthentication.SELF);
-
-            log.info("Uploading file");
-            if (checkBinaryExtensions(remoteFile)) {
-                log.debug("Transfer mode is set to Binary for a file upload");
-                ftpClient.setType(Session.TYPE_IMAGE);
-            }
-
-            ftpClient.put(remoteFile, new DataSourceStream(io), new MarkerListener() {
-                public void markerArrived(Marker marker) {
-                }
-            });
-
-            log.info("Upload file to:" + remoteFile + " is done");
-
-        } catch (ServerException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e);
-        } catch (IOException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e);
-        } catch (ClientException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e);
-        } finally {
-            if (ftpClient != null) {
-                try {
-                    ftpClient.close();
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection",e);
-                }
-            }
-        }
-    }
-
-    public void uploadFile(URI srcURI,  URI destURI, GSSCredential gsCredential) throws ToolsException {
-        GridFTPClient srcClient = null;
-        GridFTPContactInfo destContactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort());
-        GridFTPContactInfo srcContactInfo = new GridFTPContactInfo(srcURI.getHost(),srcURI.getPort());
-        try {
-            String remoteFile = destURI.getPath();
-            log.info("The remote file is " + remoteFile);
-            log.debug("Setup GridFTP Client");
-            srcClient = new GridFTPClient(srcContactInfo.hostName, srcContactInfo.port);
-            srcClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-            srcClient.authenticate(gsCredential);
-            srcClient.setDataChannelAuthentication(DataChannelAuthentication.SELF);
-
-            GridFTPClient destClient = new GridFTPClient(destContactInfo.hostName, destContactInfo.port);
-            destClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-            destClient.authenticate(gsCredential);
-            destClient.setDataChannelAuthentication(DataChannelAuthentication.SELF);
-            log.debug("Uploading file");
-            if (checkBinaryExtensions(remoteFile)) {
-                log.debug("Transfer mode is set to Binary for a file upload");
-                srcClient.setType(Session.TYPE_IMAGE);
-            }
-
-            srcClient.transfer(srcURI.getPath(),destClient, remoteFile, false, null);
-
-            log.info("Upload file to:" + remoteFile + " is done");
-
-        } catch (ServerException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + destContactInfo.toString(), e);
-        } catch (IOException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + destContactInfo.toString(), e);
-        } catch (ClientException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + destContactInfo.toString(), e);
-        } finally {
-            if (srcClient != null) {
-                try {
-                    srcClient.close();
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection",e);
-                }
-            }
-        }
-    }
-
-    /**
-     * Upload file to remote location
-     *
-     * @param destURI
-     * @param gsCredential
-     * @param localFile
-     * @throws GFacException
-     */
-    public void uploadFile(URI destURI, GSSCredential gsCredential, File localFile) throws ToolsException {
-        GridFTPClient ftpClient = null;
-        GridFTPContactInfo contactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort());
-        try {
-
-            String remoteFile = destURI.getPath();
-
-            log.info("The local temp file is " + localFile);
-            log.info("the remote file is " + remoteFile);
-
-            log.debug("Setup GridFTP Client");
-
-            ftpClient = new GridFTPClient(contactInfo.hostName, contactInfo.port);
-            ftpClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-            ftpClient.authenticate(gsCredential);
-            ftpClient.setDataChannelAuthentication(DataChannelAuthentication.SELF);
-
-            log.debug("Uploading file");
-            if (checkBinaryExtensions(remoteFile)) {
-                log.debug("Transfer mode is set to Binary for a file upload");
-                ftpClient.setType(Session.TYPE_IMAGE);
-            }
-
-
-            ftpClient.put(localFile, remoteFile, false);
-
-            log.info("Upload file to:" + remoteFile + " is done");
-
-        } catch (ServerException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e);
-        } catch (IOException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e);
-        } catch (ClientException e) {
-            throw new ToolsException("Cannot upload file to GridFTP:" + contactInfo.toString(), e);
-        } finally {
-            if (ftpClient != null) {
-                try {
-                    ftpClient.close();
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection",e);
-                }
-            }
-        }
-    }
-
-    /**
-     * Download File from remote location
-     *
-     * @param destURI
-     * @param gsCredential
-     * @param localFile
-     * @throws GFacException
-     */
-    public void downloadFile(URI destURI, GSSCredential gsCredential, File localFile) throws ToolsException {
-        GridFTPClient ftpClient = null;
-        GridFTPContactInfo contactInfo = new GridFTPContactInfo(destURI.getHost(), destURI.getPort());
-        try {
-            String remoteFile = destURI.getPath();
-
-            log.info("The local temp file is " + localFile);
-            log.info("the remote file is " + remoteFile);
-
-            log.debug("Setup GridFTP Client");
-
-            ftpClient = new GridFTPClient(contactInfo.hostName, contactInfo.port);
-            ftpClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-            ftpClient.authenticate(gsCredential);
-            ftpClient.setDataChannelAuthentication(DataChannelAuthentication.SELF);
-
-            log.debug("Downloading file");
-            if (checkBinaryExtensions(remoteFile)) {
-                log.debug("Transfer mode is set to Binary to download a file");
-                ftpClient.setType(Session.TYPE_IMAGE);
-            }
-
-            ftpClient.get(remoteFile, localFile);
-
-            log.info("Download file to:" + localFile + " is done");
-
-        } catch (ServerException e) {
-            throw new ToolsException("Cannot download file from GridFTP:" + contactInfo.toString(), e);
-        } catch (IOException e) {
-            throw new ToolsException("Cannot download file from GridFTP:" + contactInfo.toString(), e);
-        } catch (ClientException e) {
-            throw new ToolsException("Cannot download file from GridFTP:" + contactInfo.toString(), e);
-        } finally {
-            if (ftpClient != null) {
-                try {
-                    //ftpClient.close();
-                    ftpClient.close(false);
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection",e);
-                }
-            }
-        }
-    }
-
-    /**
-     * Stream remote file
-     *
-     * @param destURI
-     * @param gsCredential
-     * @param localFile
-     * @return
-     * @throws GFacException
-     */
-    public String readRemoteFile(URI destURI, GSSCredential gsCredential, File localFile) throws ToolsException {
-        BufferedReader instream = null;
-        File localTempfile = null;
-        try {
-
-            if (localFile == null) {
-                localTempfile = File.createTempFile("stderr", "err");
-            } else {
-                localTempfile = localFile;
-            }
-
-            log.info("Local temporary file:" + localTempfile);
-
-            downloadFile(destURI, gsCredential, localTempfile);
-
-            instream = new BufferedReader(new FileReader(localTempfile));
-            StringBuffer buff = new StringBuffer();
-            String temp = null;
-            while ((temp = instream.readLine()) != null) {
-                buff.append(temp);
-                buff.append(Constants.NEWLINE);
-            }
-
-            log.info("finish read file:" + localTempfile);
-
-            return buff.toString();
-        } catch (FileNotFoundException e) {
-            throw new ToolsException("Cannot read localfile file:" + localTempfile, e);
-        } catch (IOException e) {
-            throw new ToolsException("Cannot read localfile file:" + localTempfile, e);
-        } finally {
-            if (instream != null) {
-                try {
-                    instream.close();
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection",e);
-                }
-            }
-        }
-    }
-
-    /**
-     * Transfer data from one GridFTp Endpoint to another GridFTP Endpoint
-     *
-     * @param srchost
-     * @param desthost
-     * @param gssCred
-     * @param srcActive
-     * @throws ServerException
-     * @throws ClientException
-     * @throws IOException
-     */
-    public void transfer(URI srchost, URI desthost, GSSCredential gssCred, boolean srcActive) throws ToolsException {
-        GridFTPClient destClient = null;
-        GridFTPClient srcClient = null;
-
-        try {
-            destClient = new GridFTPClient(desthost.getHost(), desthost.getPort());
-            destClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-            destClient.authenticate(gssCred);
-
-            if (checkBinaryExtensions(desthost.getPath())) {
-                log.debug("Transfer mode is set to Binary");
-                destClient.setType(Session.TYPE_IMAGE);
-            }
-
-            srcClient = new GridFTPClient(srchost.getHost(), srchost.getPort());
-            srcClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-            srcClient.authenticate(gssCred);
-
-            if (checkBinaryExtensions(srchost.getPath())) {
-                log.debug("Transfer mode is set to Binary");
-                srcClient.setType(Session.TYPE_IMAGE);
-            }
-
-            if (srcActive) {
-                log.debug("Set src active");
-                HostPort hp = destClient.setPassive();
-                srcClient.setActive(hp);
-            } else {
-                log.debug("Set dst active");
-                HostPort hp = srcClient.setPassive();
-                destClient.setActive(hp);
-            }
-
-            log.debug("Start transfer file from GridFTP:" + srchost.toString() + " to " + desthost.toString());
-
-            /**
-             * Transfer a file. The transfer() function blocks until the transfer is complete.
-             */
-            srcClient.transfer(srchost.getPath(), destClient, desthost.getPath(), false, null);
-            if (srcClient.getSize(srchost.getPath()) == destClient.getSize(desthost.getPath())) {
-                log.debug("CHECK SUM OK");
-            } else {
-                log.debug("****CHECK SUM FAILED****");
-            }
-
-        } catch (ServerException e) {
-            throw new ToolsException("Cannot transfer file from GridFTP:" + srchost.toString() + " to "
-                    + desthost.toString(), e);
-        } catch (IOException e) {
-            throw new ToolsException("Cannot transfer file from GridFTP:" + srchost.toString() + " to "
-                    + desthost.toString(), e);
-        } catch (ClientException e) {
-            throw new ToolsException("Cannot transfer file from GridFTP:" + srchost.toString() + " to "
-                    + desthost.toString(), e);
-        } finally {
-            if (destClient != null) {
-                try {
-                    destClient.close();
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection at Desitnation:" + desthost.toString());
-                }
-            }
-            if (srcClient != null) {
-                try {
-                    srcClient.close();
-                } catch (Exception e) {
-                    log.warn("Cannot close GridFTP client connection at Source:" + srchost.toString(),e);
-                }
-            }
-        }
-    }
-
-	/**
-	 * List files in a GridFTP directory
-	 * @param dirURI
-	 * @param gssCred
-	 * @return
-	 * @throws ToolsException
-	 */
-    @SuppressWarnings("unchecked")
-	public List<String> listDir(URI dirURI, GSSCredential gssCred) throws ToolsException {
-    	List<String> files = new  ArrayList<String>();
-	    GridFTPClient srcClient = null;
-			try {
-				GridFTPContactInfo contactInfo = new GridFTPContactInfo(dirURI.getHost(), dirURI.getPort());
-
-				srcClient = new GridFTPClient(contactInfo.hostName, contactInfo.port);
-				srcClient.setAuthorization(new HostAuthorization(GridFtp.HOST));
-				srcClient.authenticate(gssCred);
-				srcClient.setDataChannelAuthentication(DataChannelAuthentication.SELF);
-				srcClient.setType(Session.TYPE_ASCII);
-				srcClient.changeDir(dirURI.getPath());
-
-				Vector<Object> fileInfo = null;
-				try {
-					fileInfo = srcClient.mlsd();
-				} catch (Throwable e) {
-					fileInfo = srcClient.list();
-				}
-
-				if (!fileInfo.isEmpty()) {
-					for (int j = 0; j < fileInfo.size(); ++j) {
-						String name = null;
-						if (fileInfo.get(j) instanceof MlsxEntry) {
-							name = ((MlsxEntry) fileInfo.get(j)).getFileName();
-						} else if (fileInfo.get(j) instanceof FileInfo) {
-							name = ((FileInfo) fileInfo.get(j)).getName();
-						} else {
-							throw new ToolsException("Unsupported type returned by gridftp " + fileInfo.get(j));
-						}
-
-						if (!name.equals(".") && !name.equals("..")) {
-							URI uri = GramProviderUtils.createGsiftpURI(contactInfo.hostName, dirURI.getPath() + File.separator + name);
-							files.add(uri.getPath());
-						}
-					}
-				}
-				return files;
-			} catch (IOException e) {
-				throw new ToolsException("Could not list directory: " + dirURI.toString() ,e);
-			} catch (ServerException e) {
-				throw new ToolsException("Could not list directory: " + dirURI.toString() ,e);
-			} catch (ClientException e) {
-				throw new ToolsException("Could not list directory: " + dirURI.toString() ,e);
-			} catch (URISyntaxException e) {
-				throw new ToolsException("Error creating URL of listed files: " + dirURI.toString() ,e);
-			} finally {
-				if (srcClient != null) {
-	                try {
-	                    srcClient.close();
-	                } catch (Exception e) {
-	                    log.warn("Cannot close GridFTP client connection", e);
-	                }
-	            }
-		}
-	}
-    /**
-     * Method to check file extension as binary to set transfer type
-     * @param filePath
-     * @return
-     */
-    private static boolean checkBinaryExtensions(String filePath){
-        String extension = filePath.substring(filePath.lastIndexOf(".")+1,filePath.length());
-        Set<String> extensions = new HashSet<String>(Arrays.asList(new String[] {"tar","zip","gz","tgz"}));
-        if(extensions.contains(extension)){
-            return true;
-        }else{
-            return false;
-        }
-
-    }
-
-
-
-
-    public String gridFTPFileExist(URI inputDirectory,String fileName,GSSCredential gssCred) throws ToolsException {
-        List<String> strings = listDir(inputDirectory, gssCred);
-        for(String fileExist:strings){
-            if(fileName.equals(fileExist)) {
-                fileName = "duplicate_" + fileName;
-                return fileName;
-            }
-        }
-        return fileName;
-    }
-}

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java
deleted file mode 100644
index f2ccb9a..0000000
--- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GramDirectorySetupHandler.java
+++ /dev/null
@@ -1,139 +0,0 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements.  See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership.  The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License.  You may obtain a copy of the License at
- *
- *   http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied.  See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.gfac.gram.handler;
-
-import java.net.URI;
-import java.net.URISyntaxException;
-import java.util.Properties;
-
-import org.apache.airavata.common.exception.ApplicationSettingsException;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.handler.AbstractHandler;
-import org.apache.airavata.gfac.core.handler.GFacHandlerException;
-import org.apache.airavata.gfac.core.utils.GFacUtils;
-import org.apache.airavata.gfac.gram.security.GSISecurityContext;
-import org.apache.airavata.gfac.gram.external.GridFtp;
-import org.apache.airavata.gfac.gram.util.GramProviderUtils;
-import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
-import org.apache.airavata.model.workspace.experiment.DataTransferDetails;
-import org.apache.airavata.model.workspace.experiment.ErrorCategory;
-import org.apache.airavata.model.workspace.experiment.TransferState;
-import org.apache.airavata.model.workspace.experiment.TransferStatus;
-import org.apache.airavata.registry.cpi.ChildDataType;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
-import org.apache.airavata.schemas.gfac.GlobusHostType;
-import org.apache.airavata.schemas.gfac.HostDescriptionType;
-import org.apache.airavata.schemas.gfac.UnicoreHostType;
-import org.ietf.jgss.GSSCredential;
-import org.slf4j.Logger;
-import org.slf4j.LoggerFactory;
-
-public class  GramDirectorySetupHandler extends AbstractHandler {
-    private static final Logger log = LoggerFactory.getLogger(GramDirectorySetupHandler.class);
-   
-    public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException {
-        log.info("Invoking GramDirectorySetupHandler ...");
-        super.invoke(jobExecutionContext);
-        String[] gridFTPEndpointArray = null;
-
-        //TODO: why it is tightly coupled with gridftp
-//        GlobusHostType host = (GlobusHostType) jobExecutionContext.getApplicationContext().getHostDescription().getType();
-
-        //TODO: make it more reusable
-        HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType();
-
-
-
-        if(hostType instanceof GlobusHostType){
-        	gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray();
-        }
-        else if (hostType instanceof UnicoreHostType){
-        	gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray();
-        }
-        
-
-
-        ApplicationDescription applicationDeploymentDescription = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
-        ApplicationDeploymentDescriptionType app = applicationDeploymentDescription.getType();
-        GridFtp ftp = new GridFtp();
-
-        try {
-
-            GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext.
-                    getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials();
-
-            if (gridFTPEndpointArray == null || gridFTPEndpointArray.length == 0) {
-            	gridFTPEndpointArray = new String[]{hostType.getHostAddress()};
-            }
-            boolean success = false;
-            GFacHandlerException pe = null;// = new ProviderException("");
-            for (String endpoint : gridFTPEndpointArray) {
-                try {
-
-                    URI tmpdirURI = GramProviderUtils.createGsiftpURI(endpoint, app.getScratchWorkingDirectory());
-                    URI workingDirURI = GramProviderUtils.createGsiftpURI(endpoint, app.getStaticWorkingDirectory());
-                    URI inputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getInputDataDirectory());
-                    URI outputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getOutputDataDirectory());
-
-                    log.info("Host FTP = " + gridFTPEndpointArray[0]);
-                    log.info("temp directory = " + tmpdirURI);
-                    log.info("Working directory = " + workingDirURI);
-                    log.info("Input directory = " + inputURI);
-                    log.info("Output directory = " + outputURI);
-                    ftp.makeDir(tmpdirURI, gssCred);
-                    ftp.makeDir(workingDirURI, gssCred);
-                    ftp.makeDir(inputURI, gssCred);
-                    ftp.makeDir(outputURI, gssCred);
-                    success = true;
-                    DataTransferDetails detail = new DataTransferDetails();
-                    TransferStatus status = new TransferStatus();
-                    status.setTransferState(TransferState.DIRECTORY_SETUP);
-                    detail.setTransferStatus(status);
-                    detail.setTransferDescription("Working directory = " + workingDirURI);
-                    registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID());
-                                  
-                    break;
-                } catch (URISyntaxException e) {
-                    pe = new GFacHandlerException("URI is malformatted:" + e.getMessage(), e);
-
-                } catch (Exception e) {
-              	pe = new GFacHandlerException(e.getMessage(), e);
-                }
-            }
-            if (success == false) {
-            	GFacUtils.saveErrorDetails(jobExecutionContext, pe.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.FILE_SYSTEM_FAILURE);
-        		throw pe;
-            }
-        } catch (SecurityException e) {
-            throw new GFacHandlerException(e.getMessage(), e);
-        } catch (ApplicationSettingsException e1) {
-        	throw new GFacHandlerException(e1.getMessage(), e1);
-		} catch (GFacException e) {
-            throw new GFacHandlerException(e);
-        }
-    }
-
-    public void initProperties(Properties properties) throws GFacHandlerException {
-
-    }
-}

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java
deleted file mode 100644
index ae81357..0000000
--- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPInputHandler.java
+++ /dev/null
@@ -1,203 +0,0 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements.  See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership.  The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License.  You may obtain a copy of the License at
- *
- *   http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied.  See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.gfac.gram.handler;
-
-import java.io.File;
-import java.io.FileInputStream;
-import java.io.IOException;
-import java.io.InputStream;
-import java.net.URI;
-import java.net.URISyntaxException;
-import java.util.*;
-
-import org.apache.airavata.common.exception.ApplicationSettingsException;
-import org.apache.airavata.common.utils.StringUtil;
-import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.MappingFactory;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.ToolsException;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.utils.GFacUtils;
-import org.apache.airavata.gfac.gram.security.GSISecurityContext;
-import org.apache.airavata.gfac.gram.external.GridFtp;
-import org.apache.airavata.gfac.gram.util.GramProviderUtils;
-import org.apache.airavata.gfac.core.handler.AbstractHandler;
-import org.apache.airavata.gfac.core.handler.AppDescriptorCheckHandler;
-import org.apache.airavata.gfac.core.handler.GFacHandlerException;
-import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
-import org.apache.airavata.model.workspace.experiment.DataTransferDetails;
-import org.apache.airavata.model.workspace.experiment.ErrorCategory;
-import org.apache.airavata.model.workspace.experiment.TransferState;
-import org.apache.airavata.model.workspace.experiment.TransferStatus;
-import org.apache.airavata.registry.cpi.ChildDataType;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
-import org.apache.airavata.schemas.gfac.GlobusHostType;
-import org.apache.airavata.schemas.gfac.HostDescriptionType;
-import org.apache.airavata.schemas.gfac.URIArrayType;
-import org.apache.airavata.schemas.gfac.URIParameterType;
-import org.apache.airavata.schemas.gfac.UnicoreHostType;
-import org.ietf.jgss.GSSCredential;
-import org.slf4j.Logger;
-import org.slf4j.LoggerFactory;
-
-public class GridFTPInputHandler extends AbstractHandler {
-    private static final Logger log = LoggerFactory.getLogger(AppDescriptorCheckHandler.class);
- 
-    public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException {
-        log.info("Invoking GridFTPInputHandler ...");
-        super.invoke(jobExecutionContext);
-        DataTransferDetails detail = new DataTransferDetails();
-        TransferStatus status = new TransferStatus();
-       
-        MessageContext inputNew = new MessageContext();
-        try {
-            MessageContext input = jobExecutionContext.getInMessageContext();
-            Set<String> parameters = input.getParameters().keySet();
-            for (String paramName : parameters) {
-                ActualParameter actualParameter = (ActualParameter) input.getParameters().get(paramName);
-                String paramValue = MappingFactory.toString(actualParameter);
-                //TODO: Review this with type
-                if ("URI".equals(actualParameter.getType().getType().toString())) {
-                    ((URIParameterType) actualParameter.getType()).setValue(stageInputFiles(jobExecutionContext, paramValue));
-                } else if ("URIArray".equals(actualParameter.getType().getType().toString())) {
-                    List<String> split = Arrays.asList(StringUtil.getElementsFromString(paramValue));
-                    List<String> newFiles = new ArrayList<String>();
-                    for (String paramValueEach : split) {
-                        String stageInputFiles = stageInputFiles(jobExecutionContext, paramValueEach);
-                        detail.setTransferDescription("Input Data Staged: " + stageInputFiles);
-                        status.setTransferState(TransferState.UPLOAD);
-                        detail.setTransferStatus(status);
-                        registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID());
-                   
-                        newFiles.add(stageInputFiles);
-                    }
-                    ((URIArrayType) actualParameter.getType()).setValueArray(newFiles.toArray(new String[newFiles.size()]));
-                }
-                inputNew.getParameters().put(paramName, actualParameter);
-               
-            }
-        } catch (Exception e) {
-        	 try {
-         	    status.setTransferState(TransferState.FAILED);
- 				detail.setTransferStatus(status);
- 				registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID());
- 				GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.FILE_SYSTEM_FAILURE);
- 			} catch (Exception e1) {
-  			    throw new GFacHandlerException("Error persisting status", e1, e1.getLocalizedMessage());
-  		   }
-            log.error(e.getMessage());
-            throw new GFacHandlerException("Error while input File Staging", e, e.getLocalizedMessage());
-        }
-        jobExecutionContext.setInMessageContext(inputNew);
-    }
-
-    private static String stageInputFiles(JobExecutionContext jobExecutionContext, String paramValue) throws URISyntaxException, SecurityException, ToolsException, IOException,GFacException, ApplicationSettingsException {
-        URI gridftpURL = new URI(paramValue);
-
-        String[] gridFTPEndpointArray = null;
-
-        // not to download input files to the input dir if its http / gsiftp
-        // but if local then yes
-        boolean isInputNonLocal = true;
-
-        //TODO: why it is tightly coupled with gridftp
-//        GlobusHostType host = (GlobusHostType) jobExecutionContext.getApplicationContext().getHostDescription().getType();
-
-        //TODO: make it more reusable
-        HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType();
-
-        if(jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GlobusHostType){
-        	gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray();
-        }
-        else if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof UnicoreHostType){
-        	gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray();
-        	isInputNonLocal = false;
-        }
-        else {
-        	//TODO
-        }
-
-
-        ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
-        GridFtp ftp = new GridFtp();
-        URI destURI = null;
-        GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials();
-
-        for (String endpoint : gridFTPEndpointArray) {
-            URI inputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getInputDataDirectory());
-            String fileName = new File(gridftpURL.getPath()).getName();
-            fileName = ftp.gridFTPFileExist(inputURI, fileName,gssCred);
-
-            String destLocalPath = inputURI.getPath() + File.separator + fileName;
-            //if user give a url just to refer an endpoint, not a web resource we are not doing any transfer
-            if (fileName != null && !"".equals(fileName)) {
-                destURI = GramProviderUtils.createGsiftpURI(endpoint, destLocalPath);
-                if (paramValue.startsWith("gsiftp")) {
-                	// no need to do if it is unicore, as unicore will download this on user's behalf to the job space dir
-                	if(isInputNonLocal) ftp.uploadFile(gridftpURL, destURI, gssCred);
-                	else return paramValue;
-                } else if (paramValue.startsWith("file")) {
-                    String localFile = paramValue.substring(paramValue.indexOf(":") + 1, paramValue.length());
-                    FileInputStream fis = null;
-                    try {
-                    	fis = new FileInputStream(localFile);
-                    	ftp.uploadFile(destURI, gssCred, fis);
-                    } catch (IOException e) {
-                        throw new GFacException("Unable to create file : " + localFile ,e);
-                    } finally {
-                        if (fis != null) {
-                            fis.close();
-                        }
-                    }
-                } else if (paramValue.startsWith("http")) {
-                	// no need to do if it is unicore
-                	if(isInputNonLocal) {
-                		InputStream is = null;
-                		try {
-                			is = gridftpURL.toURL().openStream();
-                			ftp.uploadFile(destURI, gssCred, (is));
-                		}finally {
-                			is.close();
-                		}
-                	} else {
-                		// don't return destUri
-                		return paramValue;
-                	}
-
-                } else {
-                    //todo throw exception telling unsupported protocol
-                    return paramValue;
-                }
-            } else {
-                // When the given input is not a web resource but a URI type input, then we don't do any transfer just keep the same value as it isin the input
-                return paramValue;
-            }
-        }
-        return destURI.getPath();
-    }
-
-    public void initProperties(Properties properties) throws GFacHandlerException {
-
-    }
-
-
-}

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java
deleted file mode 100644
index 850608f..0000000
--- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/handler/GridFTPOutputHandler.java
+++ /dev/null
@@ -1,343 +0,0 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements.  See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership.  The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License.  You may obtain a copy of the License at
- *
- *   http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied.  See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
-*/
-package org.apache.airavata.gfac.gram.handler;
-
-import java.io.BufferedReader;
-import java.io.File;
-import java.io.FileInputStream;
-import java.io.FileNotFoundException;
-import java.io.IOException;
-import java.io.InputStreamReader;
-import java.net.URI;
-import java.net.URISyntaxException;
-import java.util.*;
-
-import org.apache.airavata.common.exception.ApplicationSettingsException;
-import org.apache.airavata.common.utils.StringUtil;
-import org.apache.airavata.commons.gfac.type.ActualParameter;
-import org.apache.airavata.commons.gfac.type.ApplicationDescription;
-import org.apache.airavata.commons.gfac.type.MappingFactory;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.ToolsException;
-import org.apache.airavata.gfac.core.context.JobExecutionContext;
-import org.apache.airavata.gfac.core.context.MessageContext;
-import org.apache.airavata.gfac.core.handler.AbstractHandler;
-import org.apache.airavata.gfac.core.handler.GFacHandlerException;
-import org.apache.airavata.gfac.core.provider.GFacProviderException;
-import org.apache.airavata.gfac.core.utils.GFacUtils;
-import org.apache.airavata.gfac.core.utils.OutputUtils;
-import org.apache.airavata.gfac.gram.security.GSISecurityContext;
-import org.apache.airavata.gfac.gram.external.GridFtp;
-import org.apache.airavata.gfac.gram.util.GramProviderUtils;
-import org.apache.airavata.model.appcatalog.appinterface.OutputDataObjectType;
-import org.apache.airavata.model.workspace.experiment.CorrectiveAction;
-import org.apache.airavata.model.workspace.experiment.DataObjectType;
-import org.apache.airavata.model.workspace.experiment.DataTransferDetails;
-import org.apache.airavata.model.workspace.experiment.ErrorCategory;
-import org.apache.airavata.model.workspace.experiment.TaskDetails;
-import org.apache.airavata.model.workspace.experiment.TransferState;
-import org.apache.airavata.model.workspace.experiment.TransferStatus;
-import org.apache.airavata.registry.cpi.ChildDataType;
-import org.apache.airavata.registry.cpi.Registry;
-import org.apache.airavata.schemas.gfac.ApplicationDeploymentDescriptionType;
-import org.apache.airavata.schemas.gfac.GlobusHostType;
-import org.apache.airavata.schemas.gfac.HostDescriptionType;
-import org.apache.airavata.schemas.gfac.StringArrayType;
-import org.apache.airavata.schemas.gfac.URIArrayType;
-import org.apache.airavata.schemas.gfac.URIParameterType;
-import org.apache.airavata.schemas.gfac.UnicoreHostType;
-import org.ietf.jgss.GSSCredential;
-import org.slf4j.Logger;
-import org.slf4j.LoggerFactory;
-
-
-public class GridFTPOutputHandler extends AbstractHandler {
-    private static final Logger log = LoggerFactory.getLogger(GridFTPOutputHandler.class);
-    private Registry registry;
-
-
-    public void invoke(JobExecutionContext jobExecutionContext) throws GFacHandlerException {
-       log.info("Invoking GridFTPOutputHandler ...");
-       super.invoke(jobExecutionContext);
-        
-       ApplicationDeploymentDescriptionType app = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription().getType();
-
- 	   HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType();
- 	   String[] gridFTPEndpointArray = null;
- 	   String hostName = null;
- 
-       if(jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GlobusHostType){
-        	gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray();
-        	hostName = ((GlobusHostType) hostType).getHostName();
- 
-       }
-       else if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof UnicoreHostType){
-        	gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray();
-        	hostName = ((UnicoreHostType) hostType).getHostName();
-       }
-       else {
-        	//TODO
-       }
-
-       GridFtp ftp = new GridFtp();
-       File localStdErrFile = null;
-       Map<String, ActualParameter> stringMap = new HashMap<String, ActualParameter>();
-	   DataTransferDetails detail = new DataTransferDetails();
-	   TransferStatus status = new TransferStatus();
-
-       try {
-    	    GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials();
-    	    String[] hostgridFTP = gridFTPEndpointArray;
-            if (hostgridFTP == null || hostgridFTP.length == 0) {
-                hostgridFTP = new String[]{hostName};
-            }
-            for (String endpoint : gridFTPEndpointArray) {
-                try {
-                    /*
-                     *  Read Stdout and Stderror
-                     */
-					URI stdoutURI = GramProviderUtils.createGsiftpURI(endpoint, app.getStandardOutput());
-                    URI stderrURI = GramProviderUtils.createGsiftpURI(endpoint, app.getStandardError());
-                	status.setTransferState(TransferState.COMPLETE);
-					detail.setTransferStatus(status);
-					detail.setTransferDescription("STDOUT:" + stdoutURI.toString());
-                    registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID());
-                    status.setTransferState(TransferState.COMPLETE);
-					detail.setTransferStatus(status);
-					detail.setTransferDescription("STDERR:" + stderrURI.toString());
-                    registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID());
-                  
-                    log.info("STDOUT:" + stdoutURI.toString());
-                    log.info("STDERR:" + stderrURI.toString());
-
-                    File logDir = new File("./service_logs");
-                    if (!logDir.exists()) {
-                        logDir.mkdir();
-                    }
-
-                    String timeStampedServiceName = GFacUtils.createUniqueNameWithDate(jobExecutionContext
-                            .getApplicationName());
-                    File localStdOutFile = File.createTempFile(timeStampedServiceName, "stdout");
-                    localStdErrFile = File.createTempFile(timeStampedServiceName, "stderr");
-
-
-                    String stdout = null;
-                    String stderr = null;
-
-                    // TODO: what if job is failed
-                    // and this handler is not able to find std* files?
-                    try {
-                     stdout = ftp.readRemoteFile(stdoutURI, gssCred, localStdOutFile);
-                     stderr = ftp.readRemoteFile(stderrURI, gssCred, localStdErrFile);
-                     //TODO: do we also need to set them as output parameters for another job
-                     ApplicationDescription application = jobExecutionContext.getApplicationContext().getApplicationDeploymentDescription();
-                     ApplicationDeploymentDescriptionType appDesc = application.getType();
-                     appDesc.setStandardOutput(stdout);
-                     appDesc.setStandardError(stderr);
-                     jobExecutionContext.getApplicationContext().setApplicationDeploymentDescription(application);
-                    }
-                    catch(ToolsException e) {
-                        log.error("Cannot download stdout/err files. One reason could be the job is not successfully finished:  "+e.getMessage());
-                    }
-
-                    List<OutputDataObjectType> outputArray = new ArrayList<OutputDataObjectType>();
-                    Map<String, Object> output = jobExecutionContext.getOutMessageContext().getParameters();
-                    Set<String> keys = output.keySet();
-                    for (String paramName : keys) {
-                        ActualParameter actualParameter = (ActualParameter) output.get(paramName);
-                        if ("URIArray".equals(actualParameter.getType().getType().toString())) {
-                            URI outputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getOutputDataDirectory());
-                            List<String> outputList = ftp.listDir(outputURI, gssCred);
-                            String[] valueList = outputList.toArray(new String[outputList.size()]);
-                            ((URIArrayType) actualParameter.getType()).setValueArray(valueList);
-                            stringMap.put(paramName, actualParameter);
-                        }else if ("StringArray".equals(actualParameter.getType().getType().toString())) {
-                            String[] valueList = OutputUtils.parseStdoutArray(stdout, paramName);
-                            ((StringArrayType) actualParameter.getType()).setValueArray(valueList);
-                            stringMap.put(paramName, actualParameter);
-                        } else if ("URI".equals(actualParameter.getType().getType().toString())) {
-                        	  URI outputURI = GramProviderUtils.createGsiftpURI(endpoint, app.getOutputDataDirectory());
-                              List<String> outputList = ftp.listDir(outputURI, gssCred);
-							if (outputList.size() == 0 || outputList.get(0).isEmpty()) {
-								OutputUtils.fillOutputFromStdout(output, stdout, stderr,outputArray);
-							} else {
-								String valueList = outputList.get(0);
-								((URIParameterType) actualParameter.getType()).setValue(valueList);
-								stringMap = new HashMap<String, ActualParameter>();
-								stringMap.put(paramName, actualParameter);
-							}
-                        }
-                        else {
-                            // This is to handle exception during the output parsing.
-                            OutputUtils.fillOutputFromStdout(output, stdout, stderr,outputArray);
-                        }
-                        status.setTransferState(TransferState.DOWNLOAD);
-    					detail.setTransferStatus(status);
-    					detail.setTransferDescription("Output: " + stringMap.get(paramName).toString());
-                        registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID());
-                      
-                    }
-                    if (outputArray == null || outputArray.isEmpty()) {
-                        throw new GFacHandlerException("Empty Output returned from the Application, Double check the application" +
-                                "and ApplicationDescriptor output Parameter Names");
-                    }
-                    // If users has given an output Data path to download the output files this will download the file on machine where GFac is installed
-                    TaskDetails taskData =  jobExecutionContext.getTaskData();
-                    if(taskData != null && taskData.getAdvancedOutputDataHandling() != null){
-                    	String outputDataDirectory = taskData.getAdvancedOutputDataHandling().getOutputDataDir();
-                            if(outputDataDirectory != null && !"".equals(outputDataDirectory)){
-                                stageOutputFiles(jobExecutionContext,outputDataDirectory);
-                            }
-                    }
-                } catch (ToolsException e) {
-                    log.error(e.getMessage());
-                    throw new GFacHandlerException(e.getMessage() + "\n StdError Data: \n" +readLastLinesofStdOut(localStdErrFile.getPath(), 20),e);
-                } catch (URISyntaxException e) {
-                    log.error(e.getMessage());
-                    throw new GFacHandlerException("URI is malformatted:" + e.getMessage(), e, readLastLinesofStdOut(localStdErrFile.getPath(), 20));
-                }
-            }
-        } catch (Exception e) {
-        	 try {
-        	    status.setTransferState(TransferState.FAILED);
-				detail.setTransferStatus(status);
-				registry.add(ChildDataType.DATA_TRANSFER_DETAIL,detail, jobExecutionContext.getTaskData().getTaskID());
-				GFacUtils.saveErrorDetails(jobExecutionContext, e.getLocalizedMessage(), CorrectiveAction.CONTACT_SUPPORT, ErrorCategory.FILE_SYSTEM_FAILURE);
-	 		} catch (Exception e1) {
- 			    throw new GFacHandlerException("Error persisting status", e1, e1.getLocalizedMessage());
- 		   }
-        	log.error(e.getMessage());
-            throw new GFacHandlerException(e.getMessage(), e, readLastLinesofStdOut(localStdErrFile.getPath(), 20));
-        }
-
-    }
-
-    private static String readLastLinesofStdOut(String path, int count) {
-        StringBuffer buffer = new StringBuffer();
-        FileInputStream in = null;
-        try {
-            in = new FileInputStream(path);
-        } catch (FileNotFoundException e) {
-            e.printStackTrace();  //To change body of catch statement use File | Settings | File Templates.
-        }
-        BufferedReader br = new BufferedReader(new InputStreamReader(in));
-        List<String> strLine = new ArrayList<String>();
-        String tmp = null;
-        int numberofLines = 0;
-        try {
-            while ((tmp = br.readLine()) != null) {
-                strLine.add(tmp);
-                numberofLines++;
-            }
-        } catch (IOException e) {
-            e.printStackTrace();  //To change body of catch statement use File | Settings | File Templates.
-        }
-        if (numberofLines > count) {
-            for (int i = numberofLines - count; i < numberofLines; i++) {
-                buffer.append(strLine.get(i));
-                buffer.append("\n");
-            }
-        } else {
-            for (int i = 0; i < numberofLines; i++) {
-                buffer.append(strLine.get(i));
-                buffer.append("\n");
-            }
-        }
-        try {
-            in.close();
-        } catch (IOException e) {
-            e.printStackTrace();  //To change body of catch statement use File | Settings | File Templates.
-        }
-        return buffer.toString();
-    }
-
-    private static void stageOutputFiles(JobExecutionContext jobExecutionContext, String outputFileStagingPath) throws GFacProviderException,GFacException, ApplicationSettingsException {
-
-
-    	   HostDescriptionType hostType = jobExecutionContext.getApplicationContext().getHostDescription().getType();
-    	   String[] gridFTPEndpointArray = null;
-
-           if(jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof GlobusHostType){
-           	gridFTPEndpointArray = ((GlobusHostType) hostType).getGridFTPEndPointArray();
-           }
-           else if (jobExecutionContext.getApplicationContext().getHostDescription().getType() instanceof UnicoreHostType){
-           	gridFTPEndpointArray = ((UnicoreHostType) hostType).getGridFTPEndPointArray();
-           }
-           else {
-           	//TODO
-           }
-
-
-        MessageContext outputNew = new MessageContext();
-        MessageContext output = jobExecutionContext.getOutMessageContext();
-        Map<String, Object> parameters = output.getParameters();
-        for (String paramName : parameters.keySet()) {
-            ActualParameter actualParameter = (ActualParameter) parameters
-                    .get(paramName);
-
-            GridFtp ftp = new GridFtp();
-            GSSCredential gssCred = ((GSISecurityContext)jobExecutionContext.getSecurityContext(GSISecurityContext.GSI_SECURITY_CONTEXT)).getGssCredentials();
-            try {
-                if ("URI".equals(actualParameter.getType().getType().toString())) {
-                    for (String endpoint : gridFTPEndpointArray) {
-                        ((URIParameterType) actualParameter.getType()).setValue(doStaging(outputFileStagingPath,
-                                MappingFactory.toString(actualParameter), ftp, gssCred, endpoint));
-                    }
-                } else if ("URIArray".equals(actualParameter.getType().getType().toString())) {
-                    List<String> split = Arrays.asList(StringUtil.getElementsFromString(MappingFactory.toString(actualParameter)));
-                    List<String> newFiles = new ArrayList<String>();
-                    for (String endpoint : gridFTPEndpointArray) {
-                        for (String paramValueEach : split) {
-                            newFiles.add(doStaging(outputFileStagingPath, paramValueEach, ftp, gssCred, endpoint));
-                        }
-                        ((URIArrayType) actualParameter.getType()).setValueArray(newFiles.toArray(new String[newFiles.size()]));
-                    }
-
-                }
-            } catch (URISyntaxException e) {
-                log.error(e.getMessage());
-                throw new GFacProviderException(e.getMessage(), e);
-            } catch (ToolsException e) {
-                log.error(e.getMessage());
-                throw new GFacProviderException(e.getMessage(), e);
-            }
-            outputNew.getParameters().put(paramName, actualParameter);
-        }
-        jobExecutionContext.setOutMessageContext(outputNew);
-    }
-
-    private static String doStaging(String outputFileStagingPath, String paramValue, GridFtp ftp, GSSCredential gssCred, String endpoint) throws URISyntaxException, ToolsException {
-        URI srcURI = GramProviderUtils.createGsiftpURI(endpoint, paramValue);
-        String fileName = new File(srcURI.getPath()).getName();
-        File outputpath = new File(outputFileStagingPath);
-        if(!outputpath.exists()){
-        	outputpath.mkdirs();
-        }
-        File outputFile = new File(outputpath.getAbsolutePath() + File.separator + fileName);
-        ftp.readRemoteFile(srcURI,
-                gssCred, outputFile);
-        return outputFileStagingPath + File.separator + fileName;
-    }
-
-    public void initProperties(Properties properties) throws GFacHandlerException {
-
-    }
-}

http://git-wip-us.apache.org/repos/asf/airavata/blob/70239916/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java
----------------------------------------------------------------------
diff --git a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java b/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java
deleted file mode 100644
index 67ba1a5..0000000
--- a/modules/gfac/gfac-gram/src/main/java/org/apache/airavata/gfac/gram/persistence/DBJobPersistenceManager.java
+++ /dev/null
@@ -1,225 +0,0 @@
-/*
- *
- * Licensed to the Apache Software Foundation (ASF) under one
- * or more contributor license agreements.  See the NOTICE file
- * distributed with this work for additional information
- * regarding copyright ownership.  The ASF licenses this file
- * to you under the Apache License, Version 2.0 (the
- * "License"); you may not use this file except in compliance
- * with the License.  You may obtain a copy of the License at
- *
- *   http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing,
- * software distributed under the License is distributed on an
- * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
- * KIND, either express or implied.  See the License for the
- * specific language governing permissions and limitations
- * under the License.
- *
- */
-
-package org.apache.airavata.gfac.gram.persistence;
-
-import org.apache.airavata.common.utils.DBUtil;
-import org.apache.airavata.gfac.GFacException;
-import org.apache.airavata.gfac.core.persistence.JobData;
-import org.apache.airavata.gfac.core.persistence.JobPersistenceManager;
-import org.apache.log4j.Logger;
-import org.globus.gram.internal.GRAMConstants;
-
-import java.sql.Connection;
-import java.sql.PreparedStatement;
-import java.sql.ResultSet;
-import java.sql.SQLException;
-import java.util.ArrayList;
-import java.util.List;
-
-/**
- * User: AmilaJ (amilaj@apache.org)
- * Date: 6/18/13
- * Time: 4:16 PM
- * Database based job persistence manager. Current default implementation.
- */
-
-public class DBJobPersistenceManager implements JobPersistenceManager {
-
-    private DBUtil dbUtil;
-
-    private static final Logger log = Logger.getLogger(DBJobPersistenceManager.class);
-
-
-    public DBJobPersistenceManager(DBUtil db) {
-        this.dbUtil = db;
-    }
-
-    public synchronized void updateJobStatus(JobData jobData) throws GFacException {
-
-        if (jobData.getState() == GRAMConstants.STATUS_UNSUBMITTED) {
-            insertJob(jobData);
-        } else {
-
-            String sql = "update gram_job set status = ? where job_id = ?";
-
-            Connection connection = null;
-            PreparedStatement stmt = null;
-
-            try {
-                connection = getConnection();
-                stmt = connection.prepareStatement(sql);
-                stmt.setInt(1, jobData.getState());
-                stmt.setString(2, jobData.getJobId());
-
-                stmt.executeUpdate();
-                connection.commit();
-
-            } catch (SQLException e) {
-                throw new GFacException(e);
-            } finally {
-                try {
-                    if (stmt != null) {
-                        stmt.close();
-                    }
-
-                    if (connection != null) {
-                        connection.close();
-                    }
-
-                } catch (SQLException e) {
-                    log.error("Error closing streams", e);
-                }
-            }
-        }
-    }
-
-    private void insertJob(JobData jobData) throws GFacException {
-
-        String sql = "insert into gram_job values (?, ?)";
-
-        PreparedStatement stmt = null;
-        Connection connection = null;
-
-        try {
-            connection = getConnection();
-            stmt = connection.prepareStatement(sql);
-            stmt.setString(1, jobData.getJobId());
-            stmt.setInt(2, jobData.getState());
-
-            stmt.executeUpdate();
-        } catch (SQLException e) {
-            throw new GFacException(e);
-        } finally {
-            try {
-                if (stmt != null) {
-                    stmt.close();
-                }
-
-                if (connection != null) {
-                    connection.close();
-                }
-
-            } catch (SQLException e) {
-                log.error("Error closing streams", e);
-            }
-        }
-
-    }
-
-    public List<JobData> getRunningJobs() throws GFacException {
-
-        String sql = "select * from gram_job where status not in (?, ?, ?)";
-
-        int[] statuses = new int[3];
-        statuses[0] = GRAMConstants.STATUS_UNSUBMITTED;
-        statuses[1] = GRAMConstants.STATUS_DONE;
-        statuses[2] = GRAMConstants.STATUS_FAILED;
-
-        return getJobs(sql, statuses);
-    }
-
-    public List<JobData> getFailedJobs() throws GFacException {
-
-        String sql = "select * from gram_job where status in (?)";
-
-        int[] statuses = new int[1];
-        statuses[0] = GRAMConstants.STATUS_FAILED;
-
-        return getJobs(sql, statuses);
-    }
-
-    public List<JobData> getUnSubmittedJobs() throws GFacException {
-
-        String sql = "select * from gram_job where status in (?)";
-
-        int[] statuses = new int[1];
-        statuses[0] = GRAMConstants.STATUS_UNSUBMITTED;
-
-        return getJobs(sql, statuses);
-    }
-
-    public List<JobData> getSuccessfullyCompletedJobs() throws GFacException {
-
-        String sql = "select * from gram_job where status in (?)";
-
-        int[] statuses = new int[1];
-        statuses[0] = GRAMConstants.STATUS_DONE;
-
-        return getJobs(sql, statuses);
-
-    }
-
-
-    protected List<JobData> getJobs(String sql, int[] statuses) throws GFacException {
-
-        List<JobData> jobs = new ArrayList<JobData>();
-
-        PreparedStatement preparedStatement = null;
-        Connection connection = null;
-
-        try {
-            connection = getConnection();
-            preparedStatement = connection.prepareStatement(sql);
-
-            int index = 1;
-            for (int status : statuses) {
-                preparedStatement.setInt(index, status);
-                ++index;
-            }
-
-            ResultSet resultSet = preparedStatement.executeQuery();
-
-            while (resultSet.next()) {
-
-                String jobId = resultSet.getString("job_id");
-                int state = resultSet.getInt("status");
-
-                jobs.add(new JobData(jobId, state));
-            }
-
-        } catch (SQLException e) {
-            throw new GFacException(e);
-        } finally {
-            try {
-                if (preparedStatement != null) {
-                    preparedStatement.close();
-                }
-
-                if (connection != null) {
-                    connection.close();
-                }
-
-            } catch (SQLException e) {
-                log.error("Error closing connection", e);
-            }
-        }
-
-        return jobs;
-    }
-
-    private synchronized Connection getConnection() throws SQLException {
-        Connection connection = dbUtil.getConnection();
-        connection.setAutoCommit(true);
-
-        return connection;
-    }
-}


Mime
View raw message